DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_115858c
Line Availability available from NASC (N677904) and ABRC (SALK_115858c)
Confirmed for Hit At3g49660
Parent of DUPLO pair 8007
Parent of pair(s) none

Gene hit At3g49660

 
Sequence (A. th genome BLAST matches underlined)
GCACCCATCTCTCCATGAACTTAAATGCTAGGTTGTGTGTTAATA
GenBank Accession BZ380922 [GenBank]
Graphic View Graphic view of gene At3g49660
Predicted Position of Insertion Chr3:18414670 - go to primer design
BLAST e Value 5e-11
Hit Clone Code (BAC ID) T9C5
Hit Gene Code At3g49660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37