DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_116999c
Line Availability available from NASC (N671933) and ABRC (SALK_116999c)
Confirmed for Hit At4g02730
Parent of DUPLO pair 8007
Parent of pair(s) none

Gene hit At4g02730

 
Sequence (A. th genome BLAST matches underlined)
AACAAGTAACGGAGTCGCTAACGCGAATT
GenBank Accession BZ381608 [GenBank]
Graphic View Graphic view of gene At4g02730
Predicted Position of Insertion Chr4:1207779 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37