DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_116999c |
Line Availability | available from NASC (N671933) and ABRC (SALK_116999c) |
Confirmed for Hit | At4g02730 |
Parent of DUPLO pair | 8007 |
Parent of pair(s) | none |
Gene hit At4g02730
Sequence (A. th genome BLAST matches underlined) | AACAAGTAACGGAGTCGCTAACGCGAATT |
GenBank Accession | BZ381608 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:1207779 - go to primer design |
BLAST e Value | 6e-09 |
Hit Clone Code (BAC ID) | T10P11 |
Hit Gene Code | At4g02730 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Transducin/WD40 repeat-like superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |