DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_117783c
Line Availability available from NASC (N682819) and ABRC (SALK_117783c)
Confirmed for Hit At4g21180
Parent of DUPLO pair 637
Parent of pair(s) none

Gene hit At4g21180

 
Sequence (A. th genome BLAST matches underlined)
AAATCCTGATCCAAGTCGAAATGCTTCCTGGCCCTCTTCCTTGATAATCGTATATTTCCT
CCCTTTTGATACATTGTTATGTGTTCTTAGTATTGCTTATTTGTGTATTGTAATGGTACA
GAGGCCAATAAATATTTTGTGGAGTCCATAGCTAAAGCT
GenBank Accession BZ382042 [GenBank]
Graphic View Graphic view of gene At4g21180
Predicted Position of Insertion Chr4:11289910 - go to primer design
BLAST e Value 2e-78
Hit Clone Code (BAC ID) F7J7
Hit Gene Code At4g21180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DnaJ / Sec63 Brl domains-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37