DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_121927c
Line Availability available from NASC (N656924) and ABRC (SALK_121927c)
Confirmed for Hit At3g62730
Parent of DUPLO pair 1443
Parent of pair(s) none

Gene hit At3g62730

 
Sequence (A. th genome BLAST matches underlined)
CTAATTTGAAAGTAAGATTATGAATATATTTCTTTCACTACTTTTAGTTTTGATACATAT
TAT
GenBank Accession BZ291853 [GenBank]
Graphic View Graphic view of gene At3g62730
Predicted Position of Insertion Chr3:23208643 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F26K9
Hit Gene Code At3g62730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation desiccation-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37