DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_123093c
Line Availability available from NASC (N668965) and ABRC (SALK_123093c)
Confirmed for Hit At5g04990
Parent of DUPLO pair 12154
Parent of pair(s) none

Gene hit At5g04990

 
Sequence (A. th genome BLAST matches underlined)
ATCTTAANCAAACTCCTATGGGTCAATGGCATATGGCACACGCAGAATTGGAGAACTATG
ACGAGACCTACTGGATGATGACAAAACTTATTAA
GenBank Accession BZ292105 [GenBank]
Graphic View Graphic view of gene At5g04990
Predicted Position of Insertion Chr5:1472355 - go to primer design
BLAST e Value 1e-35
Hit Clone Code (BAC ID) MUG13
Hit Gene Code At5g04990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SAD1/UNC-84 domain protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37