DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_124719c
Line Availability available from NASC (N655916) and ABRC (SALK_124719c)
Confirmed for Hit At5g61460
Parent of DUPLO pair 2188
Parent of pair(s) none

Gene hit At5g61460

 
Sequence (A. th genome BLAST matches underlined)
CTGCATACTATATTTCAGAATCAGAAAGTTAAAAATGTTAGTCTCATCCCAACGTANAGC
TCGTAAAAGAGAGAATT
GenBank Accession BZ292560 [GenBank]
Graphic View Graphic view of gene At5g61460
Predicted Position of Insertion Chr5:24714789 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) MFB13
Hit Gene Code At5g61460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37