DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_125066c
Line Availability available from NASC (N656948) and ABRC (SALK_125066c)
Confirmed for Hit At1g30630
Parent of DUPLO pair 873
Parent of pair(s) none

Gene hit At1g30630

 
Sequence (A. th genome BLAST matches underlined)
GGTTTGCAAGATTTTCTGGGCCTTTAGCATCCTGCAGTGAGAATAAACTTCTTTAATTTC
AAACTTGTCCATTTTATAATAAACGGAATAGTTGAAAAGTTTAGATTTGGTGCCAAGGAG
TTGTTCAAGTATCCTCATAGATTTAAATCGAGTGAGCATTTCCGATGATTGATATTGAGA
ATGGGTTGTGTCTATACA
GenBank Accession BZ292722 [GenBank]
Graphic View Graphic view of gene At1g30630
Predicted Position of Insertion Chr1:10858779 - go to primer design
BLAST e Value 2e-73
Hit Clone Code (BAC ID) T5I8
Hit Gene Code At1g30630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Coatomer epsilon subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37