DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_126628c
Line Availability available from NASC (N663919) and ABRC (SALK_126628c)
Confirmed for Hit At2g20680
Parent of DUPLO pair 2716
Parent of pair(s) none

Gene hit At2g20680

 
Sequence (A. th genome BLAST matches underlined)
CTGTCACCTTTTTTGGGCTACTGGGAACGCAGAACCCTTCCAAGGCGCACATTAGACGAT
GCTTGTTGTCTACTGATGTTATGAGTGCTGTCCTTTC
GenBank Accession BZ355322 [GenBank]
Graphic View Graphic view of gene At2g20680
Predicted Position of Insertion Chr2:8922479 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F5H14
Hit Gene Code At2g20680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glycosyl hydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37