DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_127263c
Line Availability available from NASC (N670121) and ABRC (SALK_127263c)
Confirmed for Hit At3g24110
Parent of DUPLO pair 1636
Parent of pair(s) none

Gene hit At3g24110

 
Sequence (A. th genome BLAST matches underlined)
TGTTTCTTAATCCTTCTCTTAGCTTAGGAAACTTCATGATTATTGAATCCATAGACTTTA
AACTCCTGTGTCCCGGATAAATACTCCGGCTCTCCACCATTTTCCGTGCAAGCT
GenBank Accession BZ764886 [GenBank]
Graphic View Graphic view of gene At3g24110
Predicted Position of Insertion Chr3:8705242 - go to primer design
BLAST e Value 8e-59
Hit Clone Code (BAC ID) MUJ8
Hit Gene Code At3g24110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37