DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_129238c
Line Availability available from NASC (N669030) and ABRC (SALK_129238c)
Confirmed for Hit At4g03153
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g03153

 
Sequence (A. th genome BLAST matches underlined) 
TCGTCAAATTCAACAATTTGGTCTTTTTCAGTTTCAGCTTCAACATCAGACGACTCTGTT
TCTTCACACACTTCCGATCGGATCTCGTCGCATGATGATGAGTTATGGCTGTCCGAATT
GenBank Accession BZ356510 [GenBank]
Graphic View Graphic view of gene At4g03153
Predicted Position of Insertion Chr4:1395098 - go to primer design
BLAST e Value 8e-62
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03153 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Kinase interacting (KIP1-like) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37