DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_130254
Line Availability available from NASC (N630254) and ABRC (SALK_130254)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g39690

 
Sequence (A. th genome BLAST matches underlined)
TTGATGAAGATCATGTCTTAGTGGCACAGCACTCTGACTCACCTGGCTCTGTCTTGCCAA
TGTCCTCTTCTGCTCGGTCATCTGCAATTGTATCTCTTGCGTACGTCTCTGTTCGGAATA
CTGTTGAAGCT
GenBank Accession BZ357113 [GenBank]
Graphic View Graphic view of gene At2g39690
Predicted Position of Insertion Chr2:16541569 - go to primer design
BLAST e Value 8e-50
Hit Clone Code (BAC ID) F17A14
Hit Gene Code At2g39690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547)
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37