DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_132560c
Line Availability available from NASC (N679109) and ABRC (SALK_132560c)
Confirmed for Hit At5g56030
Parent of DUPLO pair none
Parent of pair(s) 96622, 96625, 96628

Gene hit At5g56030

 
Sequence (A. th genome BLAST matches underlined)
GTCAGAACGATATCTTCTACATCACTGGTGAGAGCAAGAAGGCTGTTGAGAACTCTCCAT
TCCTTGAGAAGCTCAAGAAGAAAGGTATTGAAGTTCTCTACATGGTTGATGCGATTGATG
AGTACGCTATTGGTCAGCTTAAGGAATT
GenBank Accession BZ358429 [GenBank]
Graphic View Graphic view of gene At5g56030
Predicted Position of Insertion Chr5:22688706 - go to primer design
BLAST e Value 5e-79
Hit Clone Code (BAC ID) MDA7
Hit Gene Code At5g56030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock protein 81-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37