DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_133630
Line Availability available from NASC (N633630) and ABRC (SALK_133630)
Confirmed for Hit At2g34410
Parent of DUPLO pair none
Parent of pair(s) 871, 78472, 78473

Gene hit At2g34410

 
Sequence (A. th genome BLAST matches underlined)
CTACGAAGATATGACAGTCATGTCATATTAGAGTTGTGTACAGAATAAAACACTAAGCT
GenBank Accession BZ358993 [GenBank]
Graphic View Graphic view of gene At2g34410
Predicted Position of Insertion Chr2:14521552 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-acetyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ358993 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37