DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_134490c |
Line Availability | available from NASC (N669089) and ABRC (SALK_134490c) |
Confirmed for Hit | At1g03340 |
Parent of DUPLO pair | 12741 |
Parent of pair(s) | none |
Gene hit At1g03340
Sequence (A. th genome BLAST matches underlined) | TGGTATGTGACTTTGATCAAATAACAGTTGAAT |
GenBank Accession | BZ383784 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:820076 - go to primer design |
BLAST e Value | 2e-06 |
Hit Clone Code (BAC ID) | F15K9 |
Hit Gene Code | At1g03340 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | hypothetical protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |