DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_134490c
Line Availability available from NASC (N669089) and ABRC (SALK_134490c)
Confirmed for Hit At1g03340
Parent of DUPLO pair 12741
Parent of pair(s) none

Gene hit At1g03340

 
Sequence (A. th genome BLAST matches underlined)
TGGTATGTGACTTTGATCAAATAACAGTTGAAT
GenBank Accession BZ383784 [GenBank]
Graphic View Graphic view of gene At1g03340
Predicted Position of Insertion Chr1:820076 - go to primer design
BLAST e Value 2e-06
Hit Clone Code (BAC ID) F15K9
Hit Gene Code At1g03340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37