DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_134899 |
Line Availability | available from NASC (N634899) and ABRC (SALK_134899) |
Confirmed for Hit | At4g08430 |
Parent of DUPLO pair | 2753 |
Parent of pair(s) | none |
Gene hit At4g08430
Sequence (A. th genome BLAST matches underlined) | TGTTGTTTTTCTAAACCCACAAGCT |
GenBank Accession | BZ765856 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:5349930 - go to primer design |
BLAST e Value | 1e-06 |
Hit Clone Code (BAC ID) | C18G5 |
Hit Gene Code | At4g08430 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Ulp1 protease family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | BZ765856 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |