DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_134966
Line Availability available from NASC (N634966) and ABRC (SALK_134966)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g10360

 
Sequence (A. th genome BLAST matches underlined)
TTGGCATAGGCTAATTGTGATTTCTTTTGATACCTACTTAAGGTTTTTCATCGCTTCTTA
TCGATGTTTGCCATCATTCTTTCTGTCACAAGTGGGCAAAGTCAGTTCTACATCTTCTTA
GTTCTCTTATCAGAGGCTACAACCCCGTTTGTTAATCTACGGTGGTAAGCT
GenBank Accession BZ384037 [GenBank]
Graphic View Graphic view of gene At4g10360
Predicted Position of Insertion Chr4:6421397 - go to primer design
BLAST e Value 1e-80
Hit Clone Code (BAC ID) F24G24
Hit Gene Code At4g10360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37