DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_135734c
Line Availability available from NASC (N654417) and ABRC (SALK_135734c)
Confirmed for Hit At1g56010
Parent of DUPLO pair 12000
Parent of pair(s) none

Gene hit At1g56010

 
Sequence (A. th genome BLAST matches underlined)
AACTAACCGAACAACGGCCACCGGATTTTGGAAAGCCACCGGCAAAGACAGAACCATTCT
AAGAAAGGGTAA
GenBank Accession BZ384573 [GenBank]
Graphic View Graphic view of gene At1g56010
Predicted Position of Insertion Chr1:20947656 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) F14J16
Hit Gene Code At1g56010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37