DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_136291
Line Availability available from NASC (N636291) and ABRC (SALK_136291)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g66340

 
Sequence (A. th genome BLAST matches underlined)
TCCCGTTTCTCGATCGAGCTCAGCAGCTTTATTTTTCCAGAGAAGCTCCCGAGTCTTCAC
GCTCACAAGATC
GenBank Accession BZ384991 [GenBank]
Graphic View Graphic view of gene At1g66340
Predicted Position of Insertion Chr1:24735099 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) T27F4
Hit Gene Code At1g66340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Signal transduction histidine kinase, hybrid-type, ethylene sensor
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37