DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_137266c
Line Availability available from NASC (N680552) and ABRC (SALK_137266c)
Confirmed for Hit At4g09900
Parent of DUPLO pair 2676
Parent of pair(s) none

Gene hit At4g09900

 
Sequence (A. th genome BLAST matches underlined)
CTTTTAAGAACAATATCAAATTTAAAACCTTTATAAATACTTTTGAATT
GenBank Accession BZ766325 [GenBank]
Graphic View Graphic view of gene At4g09900
Predicted Position of Insertion Chr4:6223563 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) F17A8
Hit Gene Code At4g09900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation methyl esterase 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37