DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_138624
Line Availability available from NASC (N638624) and ABRC (SALK_138624)
Confirmed for Hit At1g17950
Parent of DUPLO pair none
Parent of pair(s) 2615

Gene hit At1g17950

 
Sequence (A. th genome BLAST matches underlined)
AGAGTTTCCAACAGACAAAAAGTCGAAAAATGGAACACAATTCTCGTTAGGAATT
GenBank Accession BZ767278 [GenBank]
Graphic View Graphic view of gene At1g17950
Predicted Position of Insertion Chr1:6179042 - go to primer design
BLAST e Value 5e-24
Hit Clone Code (BAC ID) F2H15
Hit Gene Code At1g17950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 52
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37