DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_140255c
Line Availability available from NASC (N664167) and ABRC (SALK_140255c)
Confirmed for Hit At3g54800
Parent of DUPLO pair 2664
Parent of pair(s) none

Gene hit At3g54800

 
Sequence (A. th genome BLAST matches underlined)
CTTCAATTCATGCCCCATGGGAAACTATCATTGTATCACTGAAGATGGATTATATCTGTG
TATACATCAGCATGATTCACCAGATTTCTTTTGTAGAAACAGA
GenBank Accession BZ768470 [GenBank]
Graphic View Graphic view of gene At3g54800
Predicted Position of Insertion Chr3:20287903 - go to primer design
BLAST e Value 2e-16
Hit Clone Code (BAC ID) T5N23
Hit Gene Code At3g54800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pleckstrin homology (PH) and lipid-binding START domains-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37