DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_140393c
Line Availability available from NASC (N667486) and ABRC (SALK_140393c)
Confirmed for Hit At2g43010
Parent of DUPLO pair 2409
Parent of pair(s) none

Gene hit At2g43010

 
Sequence (A. th genome BLAST matches underlined)
CAGATTAAGAAATGAAGATTGATTCATTCATTGGTGTGTTTTTGCAGACTGATAAAGCT
GenBank Accession BZ768562 [GenBank]
Graphic View Graphic view of gene At2g43010
Predicted Position of Insertion Chr2:17888213 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) MFL8
Hit Gene Code At2g43010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochrome interacting factor 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37