DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_140490
Line Availability available from NASC (N640490) and ABRC (SALK_140490)
Confirmed for Hit At1g03840
Parent of DUPLO pair 2477
Parent of pair(s) none

Gene hit At1g03840

 
Sequence (A. th genome BLAST matches underlined)
CTCGCCGAGATTATTCGCGTTTCCGAAAACCCAATTGTAATCCTCTTGCGGTGAATGCGG
CTGCGGCGCCATACGGTCCTCGATGGTCACTTGCTGATGATGATTAATATTTCCTCCCGA
CCATAAAGAGAGCGTAGACGCTGGTTTCATGACGTCTTGATGATCGAAGTTGTTGGTTGT
GATTGGGAATTGGTGGTGGTGATGATGTTGC
GenBank Accession BZ768621 [GenBank]
Graphic View Graphic view of gene At1g03840
Predicted Position of Insertion Chr1:968160 - go to primer design
BLAST e Value 1e-114
Hit Clone Code (BAC ID) F21M11
Hit Gene Code At1g03840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation C2H2 and C2HC zinc fingers superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37