DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_142273
Line Availability available from NASC (N642273) and ABRC (SALK_142273)
Confirmed for Hit At1g69030
Parent of DUPLO pair 12312
Parent of pair(s) none

Gene hit At1g69030

 
Sequence (A. th genome BLAST matches underlined)
GGAAATGGATTATACCTTATCAGCACGGATTTGATCCAGAGACAGTCTTAGTGAATT
GenBank Accession ED605209 [GenBank]
Graphic View Graphic view of gene At1g69030
Predicted Position of Insertion Chr1:25948203 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) T6L1
Hit Gene Code At1g69030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BSD domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED605209 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37