DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_142629c
Line Availability available from NASC (N679180) and ABRC (SALK_142629c)
Confirmed for Hit At4g16130
Parent of DUPLO pair 1562
Parent of pair(s) none

Gene hit At4g16130

 
Sequence (A. th genome BLAST matches underlined) 
AATGTCTCTTCCAGGCACTCTCTGTCGCTGATACCCCAAGATAATTGCGTCACGTAATCT
TCTTGCACCACTTGGCTGTGACTAACATAAGACCCCACTGACAAATTTTCTGTGAAGAAT
AATT
GenBank Accession BZ769706 [GenBank]
Graphic View Graphic view of gene At4g16130
Predicted Position of Insertion Chr4:9123812 - go to primer design
BLAST e Value 2e-38
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation arabinose kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37