DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_142682c
Line Availability available from NASC (N657844) and ABRC (SALK_142682c)
Confirmed for Hit At3g24120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g24120

 
Sequence (A. th genome BLAST matches underlined)
ATTCNTTGACNCCGTTACTCANCTCGGTGGTCCTGACAGTGAGTACTACTTTGTCTACTT
ATCTCTTTGGTCAGTTTCGTTGCTCGGTCCCGTAACAAAATTCGACTTTTTTTAGGGGTT
GGATGGATCCTTCTCTCAAAGTTAAAATATTTCTGATTTCTGAAGAATATGTCTCGTTCC
TTGATTCGATGAA
GenBank Accession BZ769749 [GenBank]
Graphic View Graphic view of gene At3g24120
Predicted Position of Insertion Chr3:8707990 - go to primer design
BLAST e Value 6e-64
Hit Clone Code (BAC ID) MUJ8
Hit Gene Code At3g24120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37