DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_143038
Line Availability available from NASC (N643038) and ABRC (SALK_143038)
Parent of DUPLO pair 12283
Parent of pair(s) none

Gene hit At4g18760

 
Sequence (A. th genome BLAST matches underlined)
AGAAGGATCATGAAGATGATTAAGAACACAAGTGAAGAAAGTCCAATAGCAACACCAAGC
ACAACTTTATTAGGACCATGATGCTCTTCTTTCTTCTTCTCACTAGTATCATCTTCATTT
CCGTAATCATAATCTGAATT
GenBank Accession BZ770104 [GenBank]
Graphic View Graphic view of gene At4g18760
Predicted Position of Insertion Chr4:10308182 - go to primer design
BLAST e Value 3e-74
Hit Clone Code (BAC ID) F28A21
Hit Gene Code At4g18760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation receptor like protein 51
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37