SimpleSearch - Line and FST details


Line specific information

 
Line ID 416F03
Vector Used pAC161
Line Availability available as unconfirmed T2 stock from NASC (N2109003)
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02230

 
Sequence (A. th genome BLAST matches underlined) 
>416F03-LB-3-417697-F-150-a
GGCCATTTTTACATAACATGTCGGATACAGCCAAAAACACCAACTGGGTTCTACTAAATC
AAATATGTTTAAGGCTTGATTTGATTGGAATCTGTTCCTGTCTTTCAACTAATTTGATCC
AAAATAACAGTCAACAAACCAGCAAGCAAA
GenBank Accession KG785225 [GenBank]
Graphic View Graphic view of gene At3g02230
Predicted Position of Insertion Chr3:417697 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F14P3
Hit Gene Code At3g02230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation reversibly glycosylated polypeptide 1
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit KG785225 [GenBank]

Gene hit At1g65520

 
Sequence (A. th genome BLAST matches underlined) 
>416F03-LB-1-24361323-R-150-a
TGGCGGCTTCAACCGTCTCCGCCGCACTACCATACGCCGAATCAACAATCCCCATCTTAA
CACCCACATCCGCCGTCACTTTCGCCGCCGTCAACATCACATCCCTTCTGGCCGCCGGAG
AACCAATCTTACCCCTAATAACAGCCATAA
GenBank Accession KG785224 [GenBank]
Graphic View Graphic view of gene At1g65520
Predicted Position of Insertion Chr1:24361323 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F5I14
Hit Gene Code At1g65520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation delta(3), delta(2)-enoyl CoA isomerase 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37