SimpleSearch - Line and FST details


Line specific information

 
Line ID 001A10
Vector Used pAC106
Line Availability scheduled for transfer to NASC
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g23530

 
Sequence (A. th genome BLAST matches underlined)
>73-K026783-022-001-A10-8409
GGAGTTCTTCGAGAATCTTGGAGTATAGATGGAGGTTTCCGACCTGTCTTTCGCAGTGAG
CCCTGACAATGGGAAAGGTTGTGAATGGAGAATCCGCAAACGTGTCTCTGGCTTATTTGC
TCCAAATAAGAACGTTTTAAATCCTCATTTCTGGACAATGATCATAGAATTTGTTAGATG
TTACTGAAAACATCTTGTTATAGAAACTGCTCCCAATAGATAAAAATATATTTTGAAAGT
TTGAATAGTCACAAGATGATAATGAGTTGTTCTATCATTTTTATGTCATATATAAAACGA
ATCATAATTTCACAGTGGTATGGGATCCTCCCTATAGTGAGTCNTATTACTCACACTCAT
GNTAATATTCCTCATAAGACAACAAAGCAAGCAAGGGGGGGCGAAGGAGGTTAAATTTCA
TCCCCCCCCCAACACCGAAAATCGATAAGAATAAAAGAGGAAG
GenBank Accession CR394587 [GenBank]
Graphic View Graphic view of gene At3g23530
Predicted Position of Insertion Chr3:8438482 - go to primer design
BLAST e Value 6e-54
Hit Clone Code (BAC ID) MDB19
Hit Gene Code At3g23530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclopropane-fatty-acyl-phospholipid synthase
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR394587 [GenBank]


Last Updated on 10.06.2021 13:37