SimpleSearch - Line and FST details


Line specific information

 
Line ID 011F01
Vector Used pAC106
Line Availability only available from NASC (N401021)
Segregation Analysis 50:44:42
Confirmed for Hit F26P21 At5g05180 At3g56580
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g32640 can not be ordered because the confirmation of this insertion failed.

Gene hit F26P21

 
Sequence (A. th genome BLAST matches underlined)
>06-K012257-022-011-F01-8409
AATTCGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAATATATTCTAAC
TTGACACTAATTAAATTACTTCTATTAATCACATGCCACGTAATTATAAATTGAGCGAAT
AATGAACTCAAAAACTCTATAGTTCAACCACATTTGAGCTATGGGATCCTCCCTATAGTG
AGTCGTATTACTCAAGCATNGGNGGGGGTTTTAGCGTGTTTCCAAAATCATACTTTTTGA
AACACCGCTATATATTGCGAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGA
TATCCTGGTTTGAAATCTCCTCTACCGAAGCTTTGGTAAAATTCAAAGCAAAGCAAGACA
TGTAAATTTTTATGGGATCCTCCTTATAGTGAGTGGGATCTACTCACACATTATTATAGA
GAGAGATACATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCT
GCAGCCAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTTCGAGAGAAAATTGAA
TCGAACCGAACCCAATAATTAATAGGTAAAACTTTGATAACTGGTGGGGCATGTGGTAGA
TGTTTGGCCACTA
GenBank Accession AL752244 [GenBank]
Graphic View Graphic view of sequence AL752244 of line 011F01
Predicted Position of Insertion Chr4:15944212 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) F26P21
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752244 [GenBank]

Gene hit At4g32640

 
Sequence (A. th genome BLAST matches underlined)
>06-K013046-022-011-F01-35St
AACGCATTCCAACTGACATTGATCTACCATCGGCCATTGGATCCTCTTTACATTCTTCCA
CTAGTAAAGACCCGCCTGCCTCGTGTGCCTACTCAGCTGTTGTTGACATCATTGACACAC
ATGTCTGCATGTGGTC
GenBank Accession AL752246 [GenBank]
Graphic View Graphic view of gene At4g32640
Predicted Position of Insertion Chr4:15747868 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) F4D11
Hit Gene Code At4g32640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sec23/Sec24 protein transport family protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g05180

 
Sequence (A. th genome BLAST matches underlined)
>06-K012256-022-011-F01-8409
ATTCGATCCATGTAGATTTCCCTGACTGAAGTCCTTTACAATTGAATATAGTTCTAACTG
ACACTTAATATAAATTATTCTTTCATACATGCCATCGTAATATAAATTGAGCCGATTAAT
GAACTCAGAAACTCTATAGTTAACCACATTTGAGCTATGGGATCCTCCCTATAGTGAGTC
GTATTACTCAAACATTGGNTGGGGTTTTAGAGTGTCTTCAAAATAATACTATTTGAAACA
ACTCTATATATCGCAAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGATATC
CTGGTTTGAAATCTCCTCTACCGAACCTTTGGTAAAATTAAAAGCAAAGCAAGACATGTA
AATCTTTATGGAATCCTCCCTATATTGAGTGGATCTACTCACACATTATTATAGAGAGAG
ATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCTGCAGC
CAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTACGAGAGAAAATTGAATCGAA
CCGAACCCAATAATTAATAGGTCAAACTTTGATAACTGGTGGTGCATGTGGAGATGTGTG
GCCACTATGGGATCCTCCCTATAGTGAGTCGAATTAC
GenBank Accession AL752243 [GenBank]
Graphic View Graphic view of gene At5g05180
Predicted Position of Insertion Chr5:1535520 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) K2A11
Hit Gene Code At5g05180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cellulose synthase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g56580

 
Sequence (A. th genome BLAST matches underlined)
>06-K012257-022-011-F01-8409
AATTCGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAATATATTCTAAC
TTGACACTAATTAAATTACTTCTATTAATCACATGCCACGTAATTATAAATTGAGCGAAT
AATGAACTCAAAAACTCTATAGTTCAACCACATTTGAGCTATGGGATCCTCCCTATAGTG
AGTCGTATTACTCAAGCATNGGNGGGGGTTTTAGCGTGTTTCCAAAATCATACTTTTTGA
AACACCGCTATATATTGCGAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGA
TATCCTGGTTTGAAATCTCCTCTACCGAAGCTTTGGTAAAATTCAAAGCAAAGCAAGACA
TGTAAATTTTTATGGGATCCTCCTTATAGTGAGTGGGATCTACTCACACATTATTATAGA
GAGAGATACATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCT
GCAGCCAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTTCGAGAGAAAATTGAA
TCGAACCGAACCCAATAATTAATAGGTAAAACTTTGATAACTGGTGGGGCATGTGGTAGA
TGTTTGGCCACTA
GenBank Accession AL752244 [GenBank]
Graphic View Graphic view of gene At3g56580
Predicted Position of Insertion Chr3:20962189 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752245 [GenBank] AL752243 [GenBank]


Last Updated on 31.08.2016 09:40