SimpleSearch - Line and FST details


Line specific information

 
Line ID 011F01
Vector Used pAC106
Line Availability available as T3 set from NASC (N401021)
Segregation Analysis 50:44:42
Confirmed for Hit F26P21 At5g05180 At3g56580
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit F26P21

 
Sequence (A. th genome BLAST matches underlined)
>06-K012257-022-011-F01-8409
AATTCGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAATATATTCTAAC
TTGACACTAATTAAATTACTTCTATTAATCACATGCCACGTAATTATAAATTGAGCGAAT
AATGAACTCAAAAACTCTATAGTTCAACCACATTTGAGCTATGGGATCCTCCCTATAGTG
AGTCGTATTACTCAAGCATNGGNGGGGGTTTTAGCGTGTTTCCAAAATCATACTTTTTGA
AACACCGCTATATATTGCGAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGA
TATCCTGGTTTGAAATCTCCTCTACCGAAGCTTTGGTAAAATTCAAAGCAAAGCAAGACA
TGTAAATTTTTATGGGATCCTCCTTATAGTGAGTGGGATCTACTCACACATTATTATAGA
GAGAGATACATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCT
GCAGCCAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTTCGAGAGAAAATTGAA
TCGAACCGAACCCAATAATTAATAGGTAAAACTTTGATAACTGGTGGGGCATGTGGTAGA
TGTTTGGCCACTA
GenBank Accession AL752244 [GenBank]
Graphic View Graphic view of sequence AL752244 of line 011F01
Predicted Position of Insertion Chr4:15944212 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) F26P21
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752244 [GenBank]

Gene hit At4g32640

 
Sequence (A. th genome BLAST matches underlined)
>06-K013046-022-011-F01-35St
AACGCATTCCAACTGACATTGATCTACCATCGGCCATTGGATCCTCTTTACATTCTTCCA
CTAGTAAAGACCCGCCTGCCTCGTGTGCCTACTCAGCTGTTGTTGACATCATTGACACAC
ATGTCTGCATGTGGTC
GenBank Accession AL752246 [GenBank]
Graphic View Graphic view of gene At4g32640
Predicted Position of Insertion Chr4:15747868 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) F4D11
Hit Gene Code At4g32640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sec23/Sec24 protein transport family protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g05180

 
Sequence (A. th genome BLAST matches underlined)
>06-K012256-022-011-F01-8409
ATTCGATCCATGTAGATTTCCCTGACTGAAGTCCTTTACAATTGAATATAGTTCTAACTG
ACACTTAATATAAATTATTCTTTCATACATGCCATCGTAATATAAATTGAGCCGATTAAT
GAACTCAGAAACTCTATAGTTAACCACATTTGAGCTATGGGATCCTCCCTATAGTGAGTC
GTATTACTCAAACATTGGNTGGGGTTTTAGAGTGTCTTCAAAATAATACTATTTGAAACA
ACTCTATATATCGCAAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGATATC
CTGGTTTGAAATCTCCTCTACCGAACCTTTGGTAAAATTAAAAGCAAAGCAAGACATGTA
AATCTTTATGGAATCCTCCCTATATTGAGTGGATCTACTCACACATTATTATAGAGAGAG
ATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCTGCAGC
CAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTACGAGAGAAAATTGAATCGAA
CCGAACCCAATAATTAATAGGTCAAACTTTGATAACTGGTGGTGCATGTGGAGATGTGTG
GCCACTATGGGATCCTCCCTATAGTGAGTCGAATTAC
GenBank Accession AL752243 [GenBank]
Graphic View Graphic view of gene At5g05180
Predicted Position of Insertion Chr5:1535520 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) K2A11
Hit Gene Code At5g05180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cellulose synthase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g56580

 
Sequence (A. th genome BLAST matches underlined)
>06-K012257-022-011-F01-8409
AATTCGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAATATATTCTAAC
TTGACACTAATTAAATTACTTCTATTAATCACATGCCACGTAATTATAAATTGAGCGAAT
AATGAACTCAAAAACTCTATAGTTCAACCACATTTGAGCTATGGGATCCTCCCTATAGTG
AGTCGTATTACTCAAGCATNGGNGGGGGTTTTAGCGTGTTTCCAAAATCATACTTTTTGA
AACACCGCTATATATTGCGAGGCATATATCATATTTGATACTGAATTAATGCCCGTGTGA
TATCCTGGTTTGAAATCTCCTCTACCGAAGCTTTGGTAAAATTCAAAGCAAAGCAAGACA
TGTAAATTTTTATGGGATCCTCCTTATAGTGAGTGGGATCTACTCACACATTATTATAGA
GAGAGATACATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGCAGGTCGACCT
GCAGCCAAGCTACAAAATTGGTATATGTTCGGTTTACGTTATTTTCGAGAGAAAATTGAA
TCGAACCGAACCCAATAATTAATAGGTAAAACTTTGATAACTGGTGGGGCATGTGGTAGA
TGTTTGGCCACTA
GenBank Accession AL752244 [GenBank]
Graphic View Graphic view of gene At3g56580
Predicted Position of Insertion Chr3:20962189 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752245 [GenBank] AL752243 [GenBank]


Last Updated on 06.12.2018 14:50