SimpleSearch - Line and FST details


Line specific information

 
Line ID 044H05
Vector Used pAC161
Line Availability available as T3 set from NASC (N404217)
Segregation Analysis 50:43:35
Confirmed for Hit T12K4 At1g48520
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At5g66880

 
Sequence (A. th genome BLAST matches underlined)
>40-K026600-022-044-H05-8409
CGGACAGAAGCCTTTACAATTGAATATATGCCGCCCTACATCGTCTCGTTACCAGAGTCT
TGCTATTGTGGGAGATCTTTTTCCACTTATTTTCGCGAATCTTCGTCTTCTTCCTATGGG
ATCCGCCCTATAGTGAGACTATGGGATCCTCCCTATAGCGAGTGGGATTACCCCCACCCG
TGTGGGATCCTCCCTAGAGTGAGAATGGTTGCCGGCCCATATTGGGATGTCA
GenBank Accession CR396050 [GenBank]
Graphic View Graphic view of gene At5g66880
Predicted Position of Insertion Chr5:26710541 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) MUD21
Hit Gene Code At5g66880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose nonfermenting 1(SNF1)-related protein kinase 2.3
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 800C12

Gene hit At3g42624

 
Sequence (A. th genome BLAST matches underlined)
>40-K015474-022-044-H05-8409
TAGTGAGAGGTGAACTACATGGAAACGTCATCGTCCTACTATCTTGAGTAGTAAGCAGGG
GCCGAAGTTGAGGCGGGAGGATTTTGCTCGTTCTGTCCGGTCGAGCGTATGGAAGCTCGT
CTCTATGGGATCCTCCCTATAGTGAGAAGAAAAAGAACGAGTAATTACCACTTTTTTTTC
AACCCAAAAAAGTAAATATCCGCA
GenBank Accession AL763967 [GenBank]
Graphic View Graphic view of gene At3g42624
Predicted Position of Insertion Chr3:14714633 - go to primer design
BLAST e Value 9e-39
Hit Clone Code (BAC ID) T12K4
Hit Gene Code At3g42624 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL763967 [GenBank]

Gene hit At1g48520

 
Sequence (A. th genome BLAST matches underlined)
>49-011521-rosso-H5-35St
CTTGAGTAAGGGATGACGCACAATNCCACTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTAGTAAATAATGAACTTTGGAATTCAACAACTTTGGAAT
TCAAAACAGGCAAAGCACCAGGCAAACCCATACAAACAGGACAAATACTTGTGTTTGGAT
AAGAACCGTAATTGTTAGAGCAACTACAAAAGGCTTTTGTCAATGTAGAGAGCTGAACAT
GAGTCTCTATCCCAATTACAGCTTCGTAATCTCTCAGAATCTCATCAAGTTGGTTGCTTT
TGTGGTTTTTTGGAGCAACCCTTGTTGGAGAAGACTGTTTAGCTTCATGGGTCGTCGTTG
TTTGGCTTCCACAAGACCTCACGGAGAAGTTGTTACTCCTTCTCCTTCTTAACAAGCTAG
TTCCGAGAAGTGAGAACTGGTTTAGCTGAATTGTTCTCAACAATGTGGGATACATGTTTT
AAGGTGGGATCTAATACTTTCGGGTTGAAAATTCCANTCCCCTCCTCATAACATAATTTA
AAACATAAATA
GenBank Accession AL763966 [GenBank]
Graphic View Graphic view of gene At1g48520
Predicted Position of Insertion Chr1:17940564 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1N15
Hit Gene Code At1g48520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GLU-ADT subunit B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 06.12.2018 14:50