SimpleSearch - Line and FST details


Line specific information

 
Line ID 048G03
Vector Used pAC161
Line Availability available as T3 set from NASC (N404587)
Segregation Analysis 50:33:29
Confirmed for Hit At3g05750
Parent of DUPLO pair none
Parent of pair(s) 2381, 95356

Gene hit At3g05750

Sequence (A. th genome BLAST matches underlined)
>23-K016077-022-048-G03-8409
TGCACCCGGTGGAGAAACCAACCAAGGGCTTCAAGACAAGAACCATTTGAACTTAAACCA
AAACTGATAGAGCATTAAAGTAGACATTACCGGAGAGTTTCGAGCTGCTGCTGCTATGGG
ATCCTCCCTATAGTGAG
GenBank Accession AL936406 [GenBank]
Graphic View Graphic view of gene At3g05750
Predicted Position of Insertion Chr3:1704895 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F18C1
Hit Gene Code At3g05750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine-rich adhesin for platelets-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details