SimpleSearch - Line and FST details


Line specific information

 
Line ID 067A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N406345)
Segregation Analysis 50:36:23
Confirmed for Hit At5g59800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g59800

Sequence (A. th genome BLAST matches underlined)
>65-011693-strizhov-A9-oriL
GGAATCCTCCCTCATAGAGACACGCGTTACTCATTTACTTCTCCAGCCAAGTGTCTGTGA
ATAGCTTCTAGTGATGAAAACTGTCTACCAGTCCCTGGCTCGATAAAGTATGGGATCCTC
CCTATAGTGAGTCGTATTACTCN
GenBank Accession AL755182 [GenBank]
Graphic View Graphic view of gene At5g59800
Predicted Position of Insertion Chr5:24095776 - go to primer design
BLAST e Value 1e-37
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation methyl-CPG-binding domain 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details