SimpleSearch - Line and FST details


Line specific information

 
Line ID 108C10
Vector Used pAC161
Line Availability available as T3 set from NASC (N410306)
Segregation Analysis 100:74:65
Confirmed for Hit At2g28160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g28160

Sequence (A. th genome BLAST matches underlined)
>75-K012313-022-108-C10-8409
TGATCCATGTAGATTTCCCGGACTGAATTGCCTGACTTAGACTCCACGTTGCTGAATCAT
TCCGTAGCTTCGACGGTGATAGTGTTAGAGCCGGTGGTGAAGAAGATGAAGAAGATTACA
ACGACGGTGATGATTCTTCAGCCACTACTACGAATAATGATGGGACCCGTAAGACGAAGA
CTGATCGGTCTATGGGATCCTCCCTATAGTGAGTCTTTTTACTC
GenBank Accession CR396243 [GenBank]
Graphic View Graphic view of gene At2g28160
Predicted Position of Insertion Chr2:12004935 - go to primer design
BLAST e Value 7e-86
Hit Clone Code (BAC ID) F24D13
Hit Gene Code At2g28160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FER-like regulator of iron uptake
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details