SimpleSearch - Line and FST details


Line specific information

 
Line ID 221A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N421126)
Segregation Analysis 50:36:27
Confirmed for Hit At3g56240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g56240

 
Sequence (A. th genome BLAST matches underlined)
>41-K014206-022-221-A06-8409
TTTTTGATCCATGTAGATCTTCCTGGACATGAAGCCATTTAGCACCACTTTNGAAAATTC
ATCAAAAAGGGTAAATATTATTAAGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL767658 [GenBank]
Graphic View Graphic view of gene At3g56240
Predicted Position of Insertion Chr3:20864104 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) F18O21
Hit Gene Code At3g56240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper chaperone
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37