SimpleSearch - Line and FST details


Line specific information

 
Line ID 238A06
Vector Used pAC161
Line Availability available as T3 set from NASC (N422758)
Segregation Analysis 82:51:40
Confirmed for Hit At3g53920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53920

Sequence (A. th genome BLAST matches underlined)
>41-K014364-022-238-A06-8409
TGATCCATGTAGATTTCCCTGACATGAAGCCTTTACANTTGATATATTCCTGTTTGTGCA
TTTTGATTTTTGGCCCTTTTTGTCTCATTTTAAACAAGCTATGGGATCCTCCCTATAGTG
AG
GenBank Accession BX942899 [GenBank]
Graphic View Graphic view of gene At3g53920
Predicted Position of Insertion Chr3:19961847 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNApolymerase sigma-subunit C
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details