SimpleSearch - Line and FST details


Line specific information

 
Line ID 285D07
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g57880 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g57880

 
Sequence (A. th genome BLAST matches underlined)
>52-K015277-022-285-D07-8409
TGATCCATGTAGATTTCCCGGACATGTAGATCTCCCGATTCTTGAATCTTTTGCTCCTCC
AATCTTCTCACCTCCATGGAGATGGCAGTTATCAAAAACTCCACAGTAACAACGGTGCAC
GGATCAAAAACCTCCCAAGTATATTGCTCATTCCATCTTGGTGTAAAGCTGTCAATGATT
GTCCGAGTTCGAATCCATTTCTGTCCGTACTTCGCCACACAATATGCATCTGTGGTTCTC
CCGGCCGTCTTTGGTTTTCATAGGCATCAGACCTGTAGCATTCAGTATCCCCAACTCCAG
TACACCGATATTAGGCTTCCATAGTTGCTTCGCTGTTGGTCTAAGATCACTGCTGTAATG
CGTAGACTCATCGAGAACGTGATACCCTCCTTCCAAACATATTCTCATGTGAATCCTGCT
ATGGGATCCTCC
GenBank Accession AL944868 [GenBank]
Graphic View Graphic view of gene At3g57880
Predicted Position of Insertion Chr3:21432163 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 285E06

Gene hit T6J22

 
Sequence (A. th genome BLAST matches underlined)
>52-K015290-022-285-D07-8409
CTGATCCATGTAGATTNTCCCGGACATGAAGTCCTTTACAATTGAATATGTAATCTATTC
TTTTTTTTTTTTTTTTTTTTAAAAAAAAAGTTAAAAACCAAAAAAAAAACTTT
GenBank Accession AL944869 [GenBank]
Graphic View Graphic view of sequence AL944869 of line 285D07
Predicted Position of Insertion Chr3:11963289 - go to primer design
BLAST e Value 4e-11
Hit Clone Code (BAC ID) T6J22
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40