SimpleSearch - Line and FST details


Line specific information

 
Line ID 326A01
Vector Used pAC161
Line Availability available as T3 set from NASC (N431201)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At5g67385
Parent of DUPLO pair none
Parent of pair(s) 69339, 97498

Gene hit At5g67385

Sequence (A. th genome BLAST matches underlined)
>01-K015978-022-326-A01-8409
TGTAGATTCCCGGACTGAAGCCATTTACACTTGAATTGGCATCATGTTGATGGTAATATT
ACGGTTAGTAAACATTTACATTCATTTGCTCTATACCGAATCCGTTTAGATGAGACTACA
AAAACTGGTAAATATTTGACATCTTGTGGTTAAGGAGATGATCAAGTTCCCATTATCTCA
AAGATTTTGAAAAACTTAAAGAGAGCGCTATGGGATCCT
GenBank Accession AL950108 [GenBank]
Graphic View Graphic view of gene At5g67385
Predicted Position of Insertion Chr5:26886293 - go to primer design
BLAST e Value 6e-68
Hit Clone Code (BAC ID) K8K14
Hit Gene Code At5g67385 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phototropic-responsive NPH3 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details