SimpleSearch - Line and FST details


Line specific information

 
Line ID 392B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N437559)
Segregation Analysis 50:50:37
Confirmed for Hit At3g55080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g55080

 
Sequence (A. th genome BLAST matches underlined)
>82-K018265-022-392-B11-8409
TGATCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAAAACGGATTTTGAAAAAT
ACTTGCAAAGTTGCATCTTATTCAAAACATCATCAAGCCCACCTGCCATAGGTGGATTTC
CCAATCGAAAGAGTATTAGTTATCTTTGCTCCAGCAATTCGCTCTAACCAGGGTAAGAAG
TTATTGTCCAACGAAGCCTATGGGATCTCCCCTTATAGTGAG
GenBank Accession BX286605 [GenBank]
Graphic View Graphic view of gene At3g55080
Predicted Position of Insertion Chr3:20415228 - go to primer design
BLAST e Value 6e-86
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286605 [GenBank]


Last Updated on 10.06.2021 13:37