SimpleSearch - Line and FST details


Line specific information

 
Line ID 543B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N452055)
Segregation Analysis 50:48:40
Confirmed for Hit At5g57620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g57620

Sequence (A. th genome BLAST matches underlined)
>82-K021951-022-543-B11-8409
AATTTTCTTAGAATCTTTGACTTTTCATGATCTTGTCGTTGTTGTTCCCCTCCAAGTGTT
AATTACGTTAGGAGA
GenBank Accession BX650081 [GenBank]
Graphic View Graphic view of gene At5g57620
Predicted Position of Insertion Chr5:23335197 - go to primer design
BLAST e Value 1e-12
Hit Clone Code (BAC ID) MUA2
Hit Gene Code At5g57620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 36
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details