SimpleSearch - Line and FST details


Line specific information

 
Line ID 545D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N452263)
Segregation Analysis 50:18:12
Confirmed for Hit At1g25510
Parent of DUPLO pair none
Parent of pair(s) 3570, 3827, 89643, 89645

Gene hit At1g25510

 
Sequence (A. th genome BLAST matches underlined) 
>77-K022079-022-545-E10-8409
NNNGGCAGTTATCCGGAATGNAGCCATTTACAATTGAATATACACGGGTAAACATCGCCT
CCCCGGCTGCTTTTTCCAGTCCAACGTTCCTTTCACGAACGAGTCTCTAAGCGAGTTATA
GATTTCGGTCTGGAGACGAGTCACGGCGGTTCCTGAGTCGATGATGATCCCACCGCTGCC
TGACTCGTCCATCTCGAAAGAAGACTGAGGAATCTGAAGCAACTCGCCGCCGACGCTTAT
TCCGGTGAGGCCTATGGGATCCTCCCTATAGTGAGACNAANGGATCCCCCCTATAG
GenBank Accession BX650371 [GenBank]
Graphic View Graphic view of gene At1g25510
Predicted Position of Insertion Chr1:8959627 - go to primer design
BLAST e Value 8e-106
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX650371 [GenBank]


Last Updated on 10.06.2021 13:37