SimpleSearch - Line and FST details


Line specific information

 
Line ID 588G12
Vector Used pGABI1
Line Availability available as T3 set from NASC (N456436)
Segregation Analysis 50:46:32
Confirmed for Hit At3g47770
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At3g47750

 
Sequence (A. th genome BLAST matches underlined)
>95-K021380-022-588-G12-8409
AGCCATTTACATTAAACATATCTTAATTATGTTCACTATATTACCACTAGGGCTTTTTAG
TGACACGTTGTAATTAATTTACAAAACAAATTGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX655341 [GenBank]
Graphic View Graphic view of gene At3g47750
Predicted Position of Insertion Chr3:17607504 - go to primer design
BLAST e Value 3e-34
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding cassette subfamily A4
Insertion Classification CDSi
Confirmation Status failed

Gene hit At3g47770

 
Sequence (A. th genome BLAST matches underlined)
>23-K121193-0022-588-G12C-8409
AACACAGCTTGAATGCATACTAGAACCACACAGAGGTACAAGGGGATCACGATCAGCCTT
ACGTTGCTCCATATGTTCCGTTTCTACAACAATGGTAACAAGATATAATTACATTTTTTC
CACGTATATATAGATAACACATGTATATTATTTGGCCAAACCTGATAAGTTAAGTTTTTC
TTGAACAATGCATTGGCCTGCGTCAAGAAACTGGCGGCAACAGGTTTCGCCATTGATGAG
TCCTGATTTGACTCTATGAGTTTACAATTCGATCTATATGCATGCCACGTTTTTATTTCC
ACTTGTGAATTATAAATGCTTTGAAATTAATTACTTTGCATTTTAACGAACAAGGGACTT
CAATTATAATATGTATAATAAGTTGCCATGGAAAGGAGTAATCCCACGACGGGACGACCA
ACAAAATTCTTATGTGTGGCGGGTGAGTTGTTGTTTCTTACATAAAATAACTTAGAATGT
TATTTTATACTAGATTTTGCGGAAATATAATATCGCTGCGGACATCTACATTTTTGTCGT
CGTTGGCGCATCGACAACCACATTGATTATCAACAGAGTTGTTAACCAGTGAATCGAACA
CAGCTTGAATGCATACTAGAACCACATCAGAGGTACAAGGGGATCACGATCAGCCTTACG
TTGCTCCATATGTTCCGTTTCTACATCTAATGGTAGCTGCGGACATTTACATTTTTTCCA
CGTATATATAGATAACACATGT
GenBank Accession LT615065 [GenBank]
Graphic View Graphic view of gene At3g47770
Predicted Position of Insertion Chr3:17618287 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC2 homolog 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 06.12.2018 14:50