SimpleSearch - Line and FST details


Line specific information

 
Line ID 588G12
Vector Used pGABI1
Line Availability only available from NASC (N456436)
Segregation Analysis 50:46:32
Confirmed for Hit At3g47770
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g47750 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g47750

 
Sequence (A. th genome BLAST matches underlined)
>95-K021380-022-588-G12-8409
AGCCATTTACATTAAACATATCTTAATTATGTTCACTATATTACCACTAGGGCTTTTTAG
TGACACGTTGTAATTAATTTACAAAACAAATTGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX655341 [GenBank]
Graphic View Graphic view of gene At3g47750
Predicted Position of Insertion Chr3:17607504 - go to primer design
BLAST e Value 3e-34
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding cassette subfamily A4
Insertion Classification CDSi
Confirmation Status failed

Gene hit At3g47770

 
Sequence (A. th genome BLAST matches underlined)
>23-K121193-0022-588-G12C-8409
AACACAGCTTGAATGCATACTAGAACCACACAGAGGTACAAGGGGATCACGATCAGCCTT
ACGTTGCTCCATATGTTCCGTTTCTACAACAATGGTAACAAGATATAATTACATTTTTTC
CACGTATATATAGATAACACATGTATATTATTTGGCCAAACCTGATAAGTTAAGTTTTTC
TTGAACAATGCATTGGCCTGCGTCAAGAAACTGGCGGCAACAGGTTTCGCCATTGATGAG
TCCTGATTTGACTCTATGAGTTTACAATTCGATCTATATGCATGCCACGTTTTTATTTCC
ACTTGTGAATTATAAATGCTTTGAAATTAATTACTTTGCATTTTAACGAACAAGGGACTT
CAATTATAATATGTATAATAAGTTGCCATGGAAAGGAGTAATCCCACGACGGGACGACCA
ACAAAATTCTTATGTGTGGCGGGTGAGTTGTTGTTTCTTACATAAAATAACTTAGAATGT
TATTTTATACTAGATTTTGCGGAAATATAATATCGCTGCGGACATCTACATTTTTGTCGT
CGTTGGCGCATCGACAACCACATTGATTATCAACAGAGTTGTTAACCAGTGAATCGAACA
CAGCTTGAATGCATACTAGAACCACATCAGAGGTACAAGGGGATCACGATCAGCCTTACG
TTGCTCCATATGTTCCGTTTCTACATCTAATGGTAGCTGCGGACATTTACATTTTTTCCA
CGTATATATAGATAACACATGT
GenBank Accession LT615065 [GenBank]
Graphic View Graphic view of gene At3g47770
Predicted Position of Insertion Chr3:17618287 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC2 homolog 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40