SimpleSearch - Line and FST details


Line specific information

 
Line ID 642B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N461555)
Segregation Analysis 50:18:13
Confirmed for Hit At5g39410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39410

 
Sequence (A. th genome BLAST matches underlined)
>50-K023272-022-642-B07-8409
ATTCCGATCACGATGAGCCCCTCCCAGAAAGCCGAACCGGTTTACGATATGGTCATACTC
GGAGCATCCGGATTTACCGGTATGCACGCAACTTAATTCTGACAACGATCGCAGAACCGG
TTTGCTTATTCTCCG
GenBank Accession BX893163 [GenBank]
Graphic View Graphic view of gene At5g39410
Predicted Position of Insertion Chr5:15770300 - go to primer design
BLAST e Value 5e-27
Hit Clone Code (BAC ID) MUL8
Hit Gene Code At5g39410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Saccharopine dehydrogenase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37