SimpleSearch - Line and FST details


Line specific information

 
Line ID 655D02
Vector Used pAC161
Line Availability available as T3 set from NASC (N462822)
Segregation Analysis 50:50:44
Confirmed for Hit At3g12990
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g12990

Sequence (A. th genome BLAST matches underlined)
>12-K023148-022-655-D02-8409
GAGCATTTACCATTGAATATATCCTGCAACACAAAGATAATTAGAGATGCAGTAGGGTTT
CGTAATCCGGAGCGGNTTCCTTTTTAGATTGNTTTCT
GenBank Accession BX893877 [GenBank]
Graphic View Graphic view of gene At3g12990
Predicted Position of Insertion Chr3:4157633 - go to primer design
BLAST e Value 5e-24
Hit Clone Code (BAC ID) MGH6
Hit Gene Code At3g12990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ribonuclease PH45A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details