SimpleSearch - Line and FST details


Line specific information

 
Line ID 673C04
Vector Used pAC161
Line Availability available as T3 set from NASC (N464540)
Segregation Analysis 50:50:33
Confirmed for Hit At3g22942
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g22942

Sequence (A. th genome BLAST matches underlined)
>27-K022991-022-673-C04-8409
CCATTTACGAAGCATATTGTTCGCAAAGGATCTACTCTCTCACTCAAGTAACATTTAGCA
TCACAAAAATCTCTTTAAAAGGAGACAGTTCTACACTACATTTCTTAAAGTCAGATCGAT
TCCATTAATCTAAGATCCAATCTTGTTAAGCATATAAAAAGGAACTATATCAAGAGACAA
GTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX661322 [GenBank]
Graphic View Graphic view of gene At3g22942
Predicted Position of Insertion Chr3:8135076 - go to primer design
BLAST e Value 2e-94
Hit Clone Code (BAC ID) F5N5
Hit Gene Code At3g22942 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-protein gamma subunit 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details