SimpleSearch - Line and FST details


Line specific information

 
Line ID 803H10
Vector Used pAC106
Line Availability available as T3 set from NASC (N477086)
Segregation Analysis 50:25:21
Confirmed for Hit At5g15980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g15980

 
Sequence (A. th genome BLAST matches underlined)
>80-K023409-022-803-H10-8409
ATTCAATTCATATATCAGTGTTATTATTACTCTTTCTTACAATTTTATTTGTTTATACCA
AAAATGGTAATGCTTTGACGGATTCCTTGCTGAAATCTGTCTTAAAGTCCTTGAGAAGCG
TGGATAGGGTTGAACAGAGCAATGAGCTGGTGAAAGAAATGAGGAGAGGAGGCT
GenBank Accession BX949857 [GenBank]
Graphic View Graphic view of gene At5g15980
Predicted Position of Insertion Chr5:5214428 - go to primer design
BLAST e Value 3e-59
Hit Clone Code (BAC ID) F1N13
Hit Gene Code At5g15980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX949857 [GenBank]


Last Updated on 10.06.2021 13:37