SimpleSearch - Line and FST details


Line specific information

 
Line ID 806H09
Vector Used pAC106
Line Availability available as T3 set from NASC (N477373)
Segregation Analysis 50:24:18
Confirmed for Hit At5g59450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g59450

Sequence (A. th genome BLAST matches underlined)
>72-K023871-022-806-H09-8409
AGCCATTTACATTGAATATATCCTGTAAAACATACATAATTTAAGAGGTTAGTTAATTTG
TGTCGGATCTATCTGCAACTACTTCTCTATGGGATCCTCCCTATAGTGAGGCGTATTACT
CCCGGGGCCCGGGCGGCTGGGTTCCCC
GenBank Accession BX950166 [GenBank]
Graphic View Graphic view of gene At5g59450
Predicted Position of Insertion Chr5:23974536 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) F2O15
Hit Gene Code At5g59450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details