SimpleSearch - Line and FST details


Line specific information

 
Line ID 824G07
Vector Used pAC106
Line Availability available as T3 set from NASC (N479087)
Segregation Analysis 50:40:27
Confirmed for Hit At1g50650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g50650

Sequence (A. th genome BLAST matches underlined)
>55-K025528-022-824-G07-8409
TACGTTCATCTTATTATTCATTAATATGACCCTTTAAAATTTATTAATCTTCTAATTAAT
TTATGTTTGGACCGCGAGGAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR360950 [GenBank]
Graphic View Graphic view of gene At1g50650
Predicted Position of Insertion Chr1:18764449 - go to primer design
BLAST e Value 1e-39
Hit Clone Code (BAC ID) F17J6
Hit Gene Code At1g50650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Stigma-specific Stig1 family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details