SimpleSearch - Line and FST details


Line specific information

 
Line ID 844D10
Vector Used pAC106
Line Availability available as T3 set from NASC (N480974)
Segregation Analysis 50:49:33
Confirmed for Hit At5g12130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g12130

Sequence (A. th genome BLAST matches underlined)
>76-K025726-022-844-D10-8409
AGCATTTACAATTGAAGTCTTGAAGGAAGTTTTGTAAGTTTCTTCTTGTTGATAATCTTT
CAGGCCTCCACTATCTACTGATGAAGAAGAGCGTGAAGTGGTTGCATTCTCATCGTTTTT
GTGTGGTAGAAGTTCTCTGCTCTCCTTCTCTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR401270 [GenBank]
Graphic View Graphic view of gene At5g12130
Predicted Position of Insertion Chr5:3920228 - go to primer design
BLAST e Value 5e-73
Hit Clone Code (BAC ID) MXC9
Hit Gene Code At5g12130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation integral membrane TerC family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details