DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026330c
Line Availability available from NASC (N665615) and ABRC (SALK_026330c)
Confirmed for Hit At3g14010
Parent of DUPLO pair 412
Parent of pair(s) none

Gene hit At3g14010

 
Sequence (A. th genome BLAST matches underlined) 
GCTAGATTTTCAGATCTCGGTTTCTTAGCTGACCAATTTAGATGAGAGATGGTGGGAATG
AATAGATTCTGTTTGTGCTTGCACTTTAGAAATTCCGTATATTCCTTTTGGAAAGCAATT
CTCTTTCTATATCTAAAGCTAGAATT
GenBank Accession BZ662837 [GenBank]
Graphic View Graphic view of gene At3g14010
Predicted Position of Insertion Chr3:4638138 - go to primer design
BLAST e Value 5e-73
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CTC-interacting domain 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37